Isolation of dsRNA from fungi samples is performed by the slightly modified methods described in the papers:

Morris TJ, Dodds JA (1979) Isolation and analysis of double-stranded RNA from virus-infected plant and fungal tissue. Phytopathology 69: 854-858.

Valverde RA, Nameth ST, Jordan RL (1990) Analysis of double-stranded RNA for plant virus diagnosis. Plant Disease 74, 255-258

ITS1 (5´TCCGTAGGTGAACCTGCGG 3´) and ITS4 (5´TCCTCCGCTTATTGATATGC 3´) primers are used for amplification of fungal ribosomal ITS region and for sequencing.